ID: 936006887_936006896

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 936006887 936006896
Species Human (GRCh38) Human (GRCh38)
Location 2:108897073-108897095 2:108897104-108897126
Sequence CCGTCTGTCATGCCCCCAATCTC TCAGGCCGAAGCTCTCGGCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 408} {0: 1, 1: 0, 2: 1, 3: 5, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!