ID: 936024614_936024618

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 936024614 936024618
Species Human (GRCh38) Human (GRCh38)
Location 2:109021727-109021749 2:109021746-109021768
Sequence CCAGGGCCACAGGGTGTGGAGGG AGGGAGCTGTGAACTCACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 110, 4: 1151} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!