ID: 936038305_936038310

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 936038305 936038310
Species Human (GRCh38) Human (GRCh38)
Location 2:109129581-109129603 2:109129596-109129618
Sequence CCGCCGCTGCTGCGCAGAGCGAG AGAGCGAGGGCGACGAGGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 91} {0: 1, 1: 0, 2: 0, 3: 13, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!