ID: 936039771_936039778

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 936039771 936039778
Species Human (GRCh38) Human (GRCh38)
Location 2:109141353-109141375 2:109141385-109141407
Sequence CCCTCTTCCTCCAACTTGCTCAG GGGCTCAGAGCCTCACTCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 361} {0: 1, 1: 0, 2: 1, 3: 25, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!