ID: 936047003_936047015

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 936047003 936047015
Species Human (GRCh38) Human (GRCh38)
Location 2:109196084-109196106 2:109196135-109196157
Sequence CCTGGCTCTAAGCCTCCTTTAAT ACGTCCCACTCAGGGTCACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 169} {0: 1, 1: 0, 2: 1, 3: 10, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!