ID: 936048107_936048111

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 936048107 936048111
Species Human (GRCh38) Human (GRCh38)
Location 2:109202267-109202289 2:109202280-109202302
Sequence CCCAGGTCCATCTCGGCAGCGTC CGGCAGCGTCTGGACCCCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 46} {0: 1, 1: 0, 2: 2, 3: 7, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!