ID: 936063587_936063593

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 936063587 936063593
Species Human (GRCh38) Human (GRCh38)
Location 2:109313857-109313879 2:109313892-109313914
Sequence CCAGAGCAGAGGGATTTGAAGAG AGATATTTGAAAGGTGTGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 211} {0: 1, 1: 0, 2: 1, 3: 20, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!