ID: 936068474_936068487

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 936068474 936068487
Species Human (GRCh38) Human (GRCh38)
Location 2:109349676-109349698 2:109349727-109349749
Sequence CCTCCAGGGGCCTCACAGGAGGA AACGGGCTGTCGCAGGGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 316} {0: 1, 1: 0, 2: 0, 3: 3, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!