ID: 936069095_936069103

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 936069095 936069103
Species Human (GRCh38) Human (GRCh38)
Location 2:109353505-109353527 2:109353525-109353547
Sequence CCCCAACATAGGGCAGCAAGGGG GGGCGCCTGGAGGGACGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 97} {0: 1, 1: 0, 2: 3, 3: 32, 4: 374}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!