|
Left Crispr |
Right Crispr |
| Crispr ID |
936069985 |
936069986 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:109361438-109361460
|
2:109361476-109361498
|
| Sequence |
CCTGGTTCTTTCTGTTTTGAAAG |
TTCAGTTTCTTTTTTTAAAATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 10, 2: 63, 3: 191, 4: 686} |
{0: 1, 1: 2, 2: 25, 3: 314, 4: 3552} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|