ID: 936073871_936073878

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 936073871 936073878
Species Human (GRCh38) Human (GRCh38)
Location 2:109389264-109389286 2:109389291-109389313
Sequence CCGCTCCTTGTGCATCAGGTTCA CTGTGCAAACAGGAGGAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 211} {0: 1, 1: 0, 2: 2, 3: 42, 4: 388}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!