ID: 936090060_936090070

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 936090060 936090070
Species Human (GRCh38) Human (GRCh38)
Location 2:109495789-109495811 2:109495835-109495857
Sequence CCCCCTTTCTTCATTTTTATAGT GGGGATAATAATACATGTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 75, 4: 914} {0: 1, 1: 0, 2: 2, 3: 26, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!