ID: 936090068_936090070

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 936090068 936090070
Species Human (GRCh38) Human (GRCh38)
Location 2:109495820-109495842 2:109495835-109495857
Sequence CCACATACATAAAATGGGGATAA GGGGATAATAATACATGTCTGGG
Strand - +
Off-target summary {0: 2, 1: 22, 2: 223, 3: 1380, 4: 4368} {0: 1, 1: 0, 2: 2, 3: 26, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!