ID: 936099566_936099573

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 936099566 936099573
Species Human (GRCh38) Human (GRCh38)
Location 2:109563364-109563386 2:109563413-109563435
Sequence CCCCCTTTCTTTTGTTTACTCTG AACAAATGCAAACAATGCAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 88, 4: 874} {0: 1, 1: 1, 2: 3, 3: 48, 4: 639}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!