ID: 936111912_936111921

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 936111912 936111921
Species Human (GRCh38) Human (GRCh38)
Location 2:109671521-109671543 2:109671545-109671567
Sequence CCAGGGCAAGGAGGAGTCCTCCC CTTCTCCTGGAGAATCTGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 2, 3: 38, 4: 464}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!