ID: 936116030_936116041

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 936116030 936116041
Species Human (GRCh38) Human (GRCh38)
Location 2:109703975-109703997 2:109704020-109704042
Sequence CCAATCACTTCTCCCACTGCCAA CTACCTAGGCTGAGGGTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 297} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!