ID: 936156681_936156688

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 936156681 936156688
Species Human (GRCh38) Human (GRCh38)
Location 2:110051517-110051539 2:110051555-110051577
Sequence CCTGCTGTGCTGAACTTCCTCCA AGTCCCATTCACAGCCCCCAGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 2, 3: 13, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!