ID: 936161260_936161275

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 936161260 936161275
Species Human (GRCh38) Human (GRCh38)
Location 2:110085822-110085844 2:110085866-110085888
Sequence CCCTCAGCCCCACTGCCCAGGAG TCGCCTCCTGCGTGGCCTGAGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 7, 3: 52, 4: 498} {0: 2, 1: 0, 2: 1, 3: 5, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!