ID: 936192045_936192060

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 936192045 936192060
Species Human (GRCh38) Human (GRCh38)
Location 2:110341336-110341358 2:110341385-110341407
Sequence CCATTTCTGTGGTGCCTCTGGCC CCCGGCTACTTCTGTCTGGCAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 1, 3: 8, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!