ID: 936198631_936198638

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 936198631 936198638
Species Human (GRCh38) Human (GRCh38)
Location 2:110390171-110390193 2:110390208-110390230
Sequence CCAAGGTTCTTAGAAAATGCTTT CCTTCTGAGCAGAGAGAGGCAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 1, 3: 36, 4: 325} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!