ID: 936214864_936214867

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 936214864 936214867
Species Human (GRCh38) Human (GRCh38)
Location 2:110544717-110544739 2:110544747-110544769
Sequence CCTGGTCTTTGTCAGATAATTTC TTCTTGTTCTTCAGGAGAAAGGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 7, 3: 28, 4: 189} {0: 6, 1: 2, 2: 3, 3: 50, 4: 539}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!