ID: 936259830_936259836

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 936259830 936259836
Species Human (GRCh38) Human (GRCh38)
Location 2:110949200-110949222 2:110949235-110949257
Sequence CCATACTCAGAGGGTCCAAGGCT CCTCCCAAGAAGGATCTGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 145} {0: 1, 1: 0, 2: 0, 3: 12, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!