ID: 936271418_936271425

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 936271418 936271425
Species Human (GRCh38) Human (GRCh38)
Location 2:111052294-111052316 2:111052327-111052349
Sequence CCTTCAGCACCATGAGAGCACAC TGACTGCAGTGGAACCATGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 283} {0: 1, 1: 0, 2: 0, 3: 60, 4: 1130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!