ID: 936277782_936277785

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 936277782 936277785
Species Human (GRCh38) Human (GRCh38)
Location 2:111115655-111115677 2:111115684-111115706
Sequence CCATTGAGACAATAATCATTCTG CTGTTGCAGTCTAGGAAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 197} {0: 1, 1: 0, 2: 1, 3: 19, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!