ID: 936279170_936279176

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 936279170 936279176
Species Human (GRCh38) Human (GRCh38)
Location 2:111122721-111122743 2:111122737-111122759
Sequence CCGGCGGAGCGCGGCGGCGGGCT GCGGGCTGGCGGGAAGGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 174} {0: 1, 1: 0, 2: 6, 3: 38, 4: 444}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!