|
Left Crispr |
Right Crispr |
Crispr ID |
936289597 |
936289604 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:111211310-111211332
|
2:111211357-111211379
|
Sequence |
CCTGCAACCTCTGCATCCCAGGT |
TCCCAAGTAGCTGGGATTATAGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 4641, 1: 61410, 2: 158925, 3: 280485, 4: 544113} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|