ID: 936289597_936289604

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 936289597 936289604
Species Human (GRCh38) Human (GRCh38)
Location 2:111211310-111211332 2:111211357-111211379
Sequence CCTGCAACCTCTGCATCCCAGGT TCCCAAGTAGCTGGGATTATAGG
Strand - +
Off-target summary No data {0: 4641, 1: 61410, 2: 158925, 3: 280485, 4: 544113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!