ID: 936304605_936304613

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 936304605 936304613
Species Human (GRCh38) Human (GRCh38)
Location 2:111329036-111329058 2:111329066-111329088
Sequence CCCACATCAGCATCCAGAGGGAG CCTGATGAGCATCCAGTGGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!