ID: 936357125_936357129

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 936357125 936357129
Species Human (GRCh38) Human (GRCh38)
Location 2:111761447-111761469 2:111761463-111761485
Sequence CCAGGACACCCAGACCAGTTTCC AGTTTCCGTACATAGACACTTGG
Strand - +
Off-target summary No data {0: 2, 1: 32, 2: 57, 3: 58, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!