ID: 936367922_936367929

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 936367922 936367929
Species Human (GRCh38) Human (GRCh38)
Location 2:111877462-111877484 2:111877487-111877509
Sequence CCCCATCAGCCAGTTTTAATAAT TCAAGCTTGGCTGGGCATGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 219} {0: 1, 1: 2, 2: 21, 3: 213, 4: 2225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!