|
Left Crispr |
Right Crispr |
| Crispr ID |
936367923 |
936367930 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:111877463-111877485
|
2:111877514-111877536
|
| Sequence |
CCCATCAGCCAGTTTTAATAATT |
CGCCTGTAATCCCAGCACTTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 2, 2: 10, 3: 75, 4: 448} |
{0: 121435, 1: 268139, 2: 223994, 3: 153979, 4: 220861} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|