ID: 936403643_936403649

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 936403643 936403649
Species Human (GRCh38) Human (GRCh38)
Location 2:112184229-112184251 2:112184252-112184274
Sequence CCCCGCTGGCTCCAGATAACAGC TCTGACCCACCAAGGGAGAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 120} {0: 1, 1: 0, 2: 3, 3: 17, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!