ID: 936419589_936419599

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 936419589 936419599
Species Human (GRCh38) Human (GRCh38)
Location 2:112350474-112350496 2:112350515-112350537
Sequence CCTTGCTCTTTACTGGTCCACAG GCATGAAAGGTCTACATGGGGGG
Strand - +
Off-target summary {0: 2, 1: 71, 2: 44, 3: 20, 4: 214} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!