ID: 936425652_936425654

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 936425652 936425654
Species Human (GRCh38) Human (GRCh38)
Location 2:112415766-112415788 2:112415788-112415810
Sequence CCACCTATTCAGGAGGCAGAGAC CAAGAGAATCACTTGAACCCAGG
Strand - +
Off-target summary {0: 7, 1: 9, 2: 564, 3: 12266, 4: 116813} {0: 1769, 1: 42452, 2: 114404, 3: 164204, 4: 204515}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!