ID: 936433973_936433976

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 936433973 936433976
Species Human (GRCh38) Human (GRCh38)
Location 2:112487246-112487268 2:112487261-112487283
Sequence CCCTGGTAACTTATGTACCCACT TACCCACTCCTCTCTGTGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 100} {0: 1, 1: 0, 2: 1, 3: 7, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!