ID: 936502134_936502145

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 936502134 936502145
Species Human (GRCh38) Human (GRCh38)
Location 2:113074762-113074784 2:113074787-113074809
Sequence CCAAGGTCCCCATTTTCCTGGGG CCAGGGAGGGAGCCGCTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 282} {0: 1, 1: 0, 2: 3, 3: 39, 4: 484}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!