ID: 936515921_936515932

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 936515921 936515932
Species Human (GRCh38) Human (GRCh38)
Location 2:113181597-113181619 2:113181632-113181654
Sequence CCTCCCTAGAAGGCAGAGATCTC CAGGCAGTCTGCTGGGTGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 144} {0: 1, 1: 0, 2: 5, 3: 93, 4: 684}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!