ID: 936538677_936538678

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 936538677 936538678
Species Human (GRCh38) Human (GRCh38)
Location 2:113332533-113332555 2:113332548-113332570
Sequence CCATCATCACTCTGCTCAGGCTG TCAGGCTGCCCCTTGAAGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 40, 4: 461} {0: 1, 1: 0, 2: 0, 3: 16, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!