ID: 936561254_936561267

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 936561254 936561267
Species Human (GRCh38) Human (GRCh38)
Location 2:113541672-113541694 2:113541717-113541739
Sequence CCCGAAAGTGAGTCCAACTTGGG CGGTCTGGCAGCGGAGAAGGTGG
Strand - +
Off-target summary No data {0: 4, 1: 0, 2: 0, 3: 6, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!