ID: 936565150_936565155

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 936565150 936565155
Species Human (GRCh38) Human (GRCh38)
Location 2:113577192-113577214 2:113577205-113577227
Sequence CCTCAGAGCCACCCACAGCCAGG CACAGCCAGGACACCTCTGCTGG
Strand - +
Off-target summary {0: 7, 1: 0, 2: 8, 3: 94, 4: 561} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!