ID: 936603573_936603581

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 936603573 936603581
Species Human (GRCh38) Human (GRCh38)
Location 2:113924756-113924778 2:113924797-113924819
Sequence CCTCCATACCTCTCATTCCCCTG AGCAGAACTGAGTTAAGACCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 388} {0: 1, 1: 0, 2: 1, 3: 21, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!