|
Left Crispr |
Right Crispr |
| Crispr ID |
936685341 |
936685352 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:114821035-114821057
|
2:114821076-114821098
|
| Sequence |
CCCTGGTACACAGACAGAGGGAG |
AGAGGGAACTTCAAGTGCCAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 18, 3: 104, 4: 329} |
{0: 1, 1: 2, 2: 19, 3: 162, 4: 779} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|