ID: 936689924_936689927

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 936689924 936689927
Species Human (GRCh38) Human (GRCh38)
Location 2:114874410-114874432 2:114874453-114874475
Sequence CCTATCTTGGTGAAGCAGGGTTT AATGAGATTACGGAGTAGACTGG
Strand - +
Off-target summary {0: 1, 1: 20, 2: 32, 3: 32, 4: 131} {0: 2, 1: 15, 2: 27, 3: 33, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!