ID: 936703805_936703810

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 936703805 936703810
Species Human (GRCh38) Human (GRCh38)
Location 2:115045580-115045602 2:115045628-115045650
Sequence CCCGCAATCACTGCACTCACCCT TGTGCCATGTGGTCCAGACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 20, 3: 75, 4: 365} {0: 1, 1: 0, 2: 0, 3: 23, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!