ID: 936720206_936720213

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 936720206 936720213
Species Human (GRCh38) Human (GRCh38)
Location 2:115242367-115242389 2:115242402-115242424
Sequence CCCATCATGTATATATCCCACAG CTCATCGATTGATGGGCATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 236} {0: 6, 1: 534, 2: 897, 3: 1244, 4: 2517}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!