ID: 936722972_936722981

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 936722972 936722981
Species Human (GRCh38) Human (GRCh38)
Location 2:115275958-115275980 2:115276006-115276028
Sequence CCCAAAGTGCTGGGATTACGGGC TAGCATATTTCAACTCTTGGTGG
Strand - +
Off-target summary {0: 1655, 1: 220799, 2: 273755, 3: 186508, 4: 142945} {0: 1, 1: 0, 2: 0, 3: 8, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!