|
Left Crispr |
Right Crispr |
| Crispr ID |
936750035 |
936750039 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:115630981-115631003
|
2:115631014-115631036
|
| Sequence |
CCAGCTCCTCTTTGTACTTCTGG |
CTGTAAATACATCTGATCCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 86, 1: 2481, 2: 4505, 3: 6313, 4: 3264} |
{0: 1, 1: 12, 2: 197, 3: 1188, 4: 1978} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|