ID: 936750037_936750039

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 936750037 936750039
Species Human (GRCh38) Human (GRCh38)
Location 2:115630987-115631009 2:115631014-115631036
Sequence CCTCTTTGTACTTCTGGTAGAAT CTGTAAATACATCTGATCCTGGG
Strand - +
Off-target summary {0: 112, 1: 2998, 2: 7837, 3: 2868, 4: 922} {0: 1, 1: 12, 2: 197, 3: 1188, 4: 1978}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!