ID: 936758028_936758032

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 936758028 936758032
Species Human (GRCh38) Human (GRCh38)
Location 2:115737904-115737926 2:115737929-115737951
Sequence CCTTTCTCTACCTCTATGCAGAG GTTCTAGTTCCCTAGGATAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 244} {0: 1, 1: 0, 2: 1, 3: 12, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!