ID: 936900316_936900321

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 936900316 936900321
Species Human (GRCh38) Human (GRCh38)
Location 2:117474512-117474534 2:117474534-117474556
Sequence CCTGCCTCACGGGAGTTCCTGAA AGGAAGCACTAAATATGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 225, 4: 2749} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!