ID: 936913488_936913492

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 936913488 936913492
Species Human (GRCh38) Human (GRCh38)
Location 2:117616092-117616114 2:117616121-117616143
Sequence CCACTCTGCTTCTGCCAGTACTG TCTATGAAGGCTCTTCCTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 320} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!